Thư mục

Hỗ trợ kỹ thuật

  • (Hotline:
    - (04) 66 745 632
    - 0982 124 899
    Email: hotro@violet.vn
    )

Thống kê

  • lượt truy cập   (chi tiết)
    trong hôm nay
  • lượt xem
    trong hôm nay
  • thành viên
  • Chào mừng quý vị đến với Thư viện Bài giảng điện tử.

    Quý vị chưa đăng nhập hoặc chưa đăng ký làm thành viên, vì vậy chưa thể tải được các tư liệu của Thư viện về máy tính của mình.
    Nếu đã đăng ký rồi, quý vị có thể đăng nhập ở ngay ô bên phải.

    DNA không ghi mã lặp lại lên tiếp và các ứng dụng


    (Bài giảng chưa được thẩm định)
    Nguồn:
    Người gửi: Nguyễn Văn Hiệp - Nguyễn Đình Tiến
    Ngày gửi: 14h:13' 21-11-2009
    Dung lượng: 2.1 MB
    Số lượt tải: 124
    Số lượt thích: 0 người

    AND không ghi mã lặp lại kế tiếp nhau và một số ứng dụng
    Tiểu luận Sinh Học Người
    Giảng viên : PGS.TS Trịnh Hồng Thái
    Nhóm sinh viên thực hiện :
    Nguyễn Hồng Trường
    Trần Trung Nam
    Vũ Mạnh Hùng
    Dương Nhật Huy
    Nguyễn Văn Hiệp
    Nội Dung
    AND Microsatellite và ứng dụng
    AND Minisatellite và ứng dụng
    AND Satellite
    Giới thiệu về DNA không ghi mã lặp lại
    kế tiếp
    AND không ghi mã lặp lại kế tiếp là gì?
    Là những đoạn trình tự ADN được lặp đi lặp lại và không tham gia làm nhiệm vụ mã hóa thông tin di truyền.
    AND không ghi mã lặp lại kế tiếp thường xuất hiện thành một khối các đoạn lặp lại liên tiếp nhau:
    Đoạn lặp đơn giản: 1 – 10 Nu
    Đoạn lặp phức tạp: hàng chục đến hàng trăm Nu
    Mỗi khối có thể xuất hiện ở một vài hoặc nhiều vị trí trên các NST khác nhau.



    Phân loại trình tự
    ADN không ghi mã lặp lại kế tiếp
    AND Satellite
    AND Minisatellite
    AND Microsatellite
    AND Satellite
    Đoạn trình tự lặp lại 1 lần mà có thể cấu tạo tới vài phần trăm của genome , dài tới 5 Mb. ADN Satellites thường tập trung ở vùng tâm động của nhiễm sắc thể do đó nó it khi được sử dụng trong phân biệt kiểu gen của các cá thể mà được sử dụng nhiều trong quá trình lập bản đồ gen ở gần vùng tâm động.
    AND satellite còn gọi là các AND vệ tinh vì các đoạn AND này có chứa những trình tự AND được lặp lại liền kề nhau hình thành nên các băng vệ tinh khi phân tích AND của hệ gen bằng phương pháp li tâm chênh lệch tỷ trọng(density gradient centrifugation).
    Một số loại DNA satellites ở người


















    AND Minisatellite
    - AND Minisatellites có mặt tại hàng trăm hoặc hàng nghìn vị trí khác nhau trên gennome mà ở đó một đơn vị lặp lại từ 10 bp cho tới 0,5-30 kb.
    Một số đặc điểm của AND Minisatellite
    - AND Minisatellitae bao gồm một loạt các đoạn ngắn có kích thước khoảng 25bp.
    - Có mặt ở trên 1000 vị trí trong hệ gen của con người
    - Một số Minisatellite có trình tự lõi cơ bản là :
    GGGCAGGGAXG
    ( X có thể là một nu bất kì )
    - AND Minisatellite bao gồm các đoạn lặp lại liên tiếp có nhiều G và C. Cácbiến thể lặp đi lặp lại liên tiếp nhau làm cho các AND minisatellite trở lên lí tưởng trong việc nghiên cứu cơ chế hoạt động của ADN.
    - Số lần lặp các đoạn là đặc trưng cho từng người.
    - Các ADN minisatellite có đặc trưng là không diễn ra hoạt động phiên mã.
    Vị trí của ADN Minisatellite
    - Trên nhiễm sắc thể, ADN Minisatelite tinhđược tìm thấy trên vùng đầu mút (telomer) và vùng tâm động (centromer), hoặc vùng dị nhiễm sắc của NST.
    - Tại đầu mút NST có những trình tự ADN ngắn (AND telomere) lặp lại ngẫu nhiên từ 5-350 lần và có trình tự đặc trưng là : 5’ TTAGGG 3’ . Trình tự này có tác dụng bảo vệ NST không bị phân hủy.

    ADN Minisatellite có 2 loại :

    - ADN tiểu vệ tinh đa vị trí (multi-locus minisatellite) : Hiện diện rải rác tại nhiều vị trí trên bộ gen.
    Các tiểu vệ tinh đa vị trí được phát hiện vào năm 1895.

    - ADN tiểu vệ tinh đơn vị trí (single-locus minisatelite) : chỉ có tại một vị trí trên bộ gen Nhiều tiểu vệ tinh đơn vị trí có giá trị dấu ấn AND.

    Các ứng dụng của AND Minisatellite
    1. Xác định đặc trưng của cá thể.
    2. Nhận dạng tội phạm và khoa học hình sự.
    3. Nghiên cứu tiến hóa.
    4. Lập bản đồ genom người.
    5. Phát hiện biến dị di truyền để ứng dụng trong
    nghiên cứu các bệnh di truyền ở người.
    6. Xác định mối quan hệ huyết thống.
    Nhận dạng cá thể
    - Mỗi người có số lượng trình tự các đoạn lặp lại ( Variable number of tDNAem repeats -VNTR ) khác nhau và đặc trưng cho mỗi cá thể.
    - Mô hình di truyền có được sau quá trình như vậy thường được gọi là “Dấu vân tay” DNA: có tác dụng nhận diện từng người như dấu vân tay là một dấu chuẩn đang dùng hiện nay.
    Nhận dạng tội phạm trong khoa học hình sự
    - ADN thu được từ các tế bào máu, tóc, da hay những bằng chứng di truyền khác mà tội phạm bỏ lại ở hiện trường được đem so sánh với các mẫu VNTR từ ADN của những người bị tình nghi, từ đó xác định được người đó phạm tội hay vô can. Các mô hình VNTR cũng rất hữu ích trong việc xác định thân phận nạn nhân trong các trường hợp giết người, hoặc từ ADN bằng chứng được tìm thấy hoặc từ chính cơ thể nạn nhân.
    - Việc so sánh các băng điện di VNTR thấy :
    - Thủ phạm thực sự là nghi phạm số 1 vì các băng điện di VNTR trong ADN thu được trên hiện trường trùng khớp với băng điện di VNTR của nghi phạm 1.

    Nghiên cứu tiến hóa
    - Việc so sánh số lượng lặp và trình tự lặp giữa các cá thể cho phép xác định quan hệ tiến hóa giữa các loài. Thường trật tự gene của các loài cùng tổ tiên thì được bảo tồn ở mức độ cao, chúng chỉ khác nhau về hàm lượng ADN ở các vùng trình tự lặp lại chứ không phải ở vùng mã hóa.
    ADN Microsatellite

    ADN Microsatellite gồm những khối nhỏ các đoạn lặp đơn giản , còn gọi là yếu tố lặp trình tự đơn giản ( Simple sequencing repeats – SSR )
    Khối các đoạn lặp 2 Nu là phổ biến nhất ( 0,5% genome ) : trong đó lặp cặp CA/GT là phổ biến và có tính đa hình cao, cặp AT/TA và cặp AG/TC thì phổ biến còn cặp CG/GC thì hiếm gặp.
    Khối các đoạn lặp 1 Nu : trong đó lặp A và T thì rất phổ biến còn lặp G và C thì rất hiếm.
    Ta có:
    - Mononucleotide SSR (A)11
    -------AAAAAAAAAAA---------------------
    - Dinucleotide SSR (GT)6
    --------------GTGTGTGTGTGT-------------
    - Trinucleotide SSR (CTG)4
    ------------CTGCTGCTGCTG-------------------
    - Tetranucleotide SSR (ACTC)4
    ----------------ACTCACTCACTCACTC----------------------
    Loại dinucleotide được tìm thấy nhiều ở động vật có vú chủ yếu là GT/AC, ở thực vật là AA/TT, AT/TA. Chúng có thể phân ra 3 loại:
    - Hoàn hảo không có sự ngắt quãng trong trình tự phối hợp
    - Ngắt quãng bao gồm kết hợp nhiều loại lặp lại
    - Ngắt quãng bị chèn bởi một hoặc nhiều base.
    Ví dụ:
    * ------CACACACACACA-------- (Hoàn hảo)
    * ------CACACACAGAGAGA----- (Phối hợp giữa CA và GA)
    * -------CACATTCACACATTCATT---- (Ngắt quãng, chèn TT)
    Các loại trình tự của ADN Microsatellite
    Trong mỗi cơ thể sẽ tồn tại hai trạng thái của các đoạn trình tự lặp là đồng hợp và dị hợp.

    Đồng hợp tử ( Homozygous ) : Số lần lặp ở locus satellite là giống nhau do đó chiều dài đoạn lặp là như nhau.

    …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…
    …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…

    5’ flanking region microsatellite locus 3’ flanking region

    Dị hợp tử ( Heterozygous ): Hai alen ở locus satellite có số lần lặp lại khác nhau. Chiều dài đoạn lặp khác nhau ở hai NST tương đồng.

    …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCT ATCGGTACTACGTGG…
    …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG…
    Một số đặc điểm của ADN Microsatellite
    - ADN Microsatellite không có hoạt động phiên mã.
    ADN Microsatelite có thể nằm trong vùng intron của gen, một số nằm trong trình tự ghi mã của gene và thường là vùng đột biến. Rất nhiều ADN Microsatellite đã được tìm ở vùng phía trên của các vùng khởi đầu sao mã của vùng mang mã .
    - Ở một số trường hợp sự thay đổi (mất hoặc thêm) các đơn vị lặp lại của ADN Microsatellite cũng làm thay đổi chức năng hoạt động của Promotor. Vị trí của ADN Microsatellite gần hay xa Promotor cũng làm hoạt động của promotor thay đổi .
    - Các đoạn nucleotide ngắn ở vùng phía trên của các trình tự hoạt hoá được hoạt động như vị trí bám cho rất nhiều các protein điều hoà đặc biệt bám vào .
    - Số lượng khác nhau của các đoạn lặp lại của ADN Microsatellite ở vùng mã hoá có quan hệ với sự biểu hiện của gen và chức năng gen. Sự thay đổi về số lượng lặp lại của các trình tự trong ADN Microsatellite có thể dẫn đến sự khác nhau về chức năng protein và hoạt động của gen và có thể ảnh hưởng tới chức năng sinh lý cũng như sự phát triển của cơ thể.
    Mặc dù hiện nay các trình tự ADN microsatellite và ADN minisatellite được ứng dụng rất rộng rãi nhưng cơ chế đột biến của chúng vẫn chưa được biết chính xác. Nhưng nghiên cứu đã chỉ ra rằng tần số đột biến ở các trình tự này cao hơn các vùng khác trên NST là khoảng 10-2 – 10-6 ở mỗi locus.
    Có hai giả thuyết được đưa ra về cơ chế đột biến cao của các đoạn lặp này :

    Cơ chế phát sinh
    1
    Qúa trình bắt chéo lỗi giữa hai NST tương đồng trong giảm phân.
    Sự trượt lỗi của enzym trong quá trình sao chép.
    2
    1
    Trong quá trình giảm phân, sự trao đổi chéo giữa các NST không tương đồng đã tạo nên những đoạn có trình tự lặp của các microsatellite thay đổi.
    Cơ chế trao đổi chéo trong giảm phân
    Trong đó có 1 NST tăng chiều dài đoạn lặp ( NST A ) và một NST giảm chiều dài
    đoạn lặp ( NST B )
    Sự trượt lỗi của enzym ADN polymerase
    trong quá trình sao chép.
    Phân tử enzym ADN polymerase trượt lỗi trong quá trình sao chép đã tạo nên một đoạn phình nhất thời, có thể bị loại bỏ trong quá trình sửa lỗi hoặc có thể kéo dài thêm ở mạch đối diện. Kết quá tạo thành đoạn lặp lại dài hơn.

    Tương tự, sự hình thành những chỗ phình cũng có thể tạo ra sự giảm của các đoạn lặp.

    Qúa trình này thường xảy ra trên mạch chậm. Do đó thường tạo ra các đoạn lặp dài hơn.
    Sự trượt lỗi của enzym ADN polymerase trong quá trình sao chép làm tăng hoặc giảm chiều dài đoạn lặp
    Các phương pháp phát hiện ADN Microsatellite
    Phát hiện nhờ sử dụng đồng vị phóng xạ
    Phát hiện ADN
    Microsatellite
    Phát hiện không sử dụng đồng vị phóng xạ
    Phương pháp phát hiện nhờ đồng vị phóng xạ

    * Phương pháp hiệu quả và xuất phát điểm phải dùng đó là dùng đồng vị phóng xạ.
    * Người ta có thể đánh dấu phóng xạ vào một đầu của primer (mồi) (end-labelling) hoặc trộn lẫn một trong bốn thành phần nucleotide A,T,G,C. được đánh dấu ( incorporation-labelling)
    * Phương pháp (end-labelling) thường được dùng hơn vì nó có nhiều ưu điểm hơn.
    * Phương pháp dùng đồng vị phóng xạ ngày nay rất ít được sử dụng vì nguy hiểm đến sức khoẻ con ngươì và việc xử lý chất thải
    Phương pháp phát hiện không dùng đồng vị phóng xạ
    Bản gen điện di huỳnh quang
    Sắc phổ
    Vai trò của ADN Microsatellite
    * ADN Microsatellite được dùng như một marker (chỉ thị) về di truyền để nghiên cứu về di truyền quần thể, quan hệ tiến hoá, lập bản đồ gen .
    * ADN Microsatellite cũng đóng vai trò là yếu tố mang mã di truyền hoặc nhân tố điều hòa .
    * Như một trình tự mang mã di truyền , ADN Microsatellite đã được tìm thấy biểu hiện ở rất nhiều protein và sự khác nhau ở số lần lặp lại của một đoạn aminoacide giống nhau liên quan đến chức năng tác động của sản phẩm protein đó.
    * ADN Microsatellite được coi như là một yếu tố chức năng của hệ gen. Những tính chất đặc biệt của ADN Microsatellite như sự đột biến điểm dẫn đến những giả thuyết cho rằng ADN Microsatellite có thể là một nguồn chủ yếu tạo nên sự đa dạng về di truyền số lượng và quá trình tiến hoá thích nghi.
    Các ứng dụng của ADN Microsatellite
    * Nhờ những tính chất của một marker ( chỉ thị ), ADN Microsatellite được áp dụng trong nhiều lĩnh vực như lập bản đồ gen người, động vật...., nghiên cứu về di truyền người những gen liên quan đến bệnh di truyền, xác định phả hệ, hình sự... trong việc xác định cấu trúc quần thể (đặc biệt là các quần thể tự nhiên) từ các loài khác nhau như vi sinh vật, thực vật, động vật có vú, côn trùng, chim....
    Ví dụ:
    * Trong chuẩn đoán bệnh:
    - Vì ADN Microsatellite thay đổi về chiều dài trong sự phát triển của một số bệnh ung thư, chúng là những marker rất hữu ích trong việc dò tìm, phát hiện ung thư sớm. Bởi vì tính đa hình của chúng hữu ích trong sự nghiên cứu các liên kết để định vị những Gen chiụ trách nhiệm về nhiều sự mất trật tự di truyền học
    * Nghiên cứu quần thể :
    - ADN Microsatellite có thể được sử dụng để phát hiện ra thay đổi đột ngột trong quần thể, hiệu ứng của sự phân đoạn quần thể và sự tương tác của những quần thể khác nhau. Microsatellite hữu ích trong sự nhận ra của những quần thể phôi thai và quần thể mới
    Tài liệu tham khảo
    Bài giảng Sinh học người của Thầy Trịnh Hồng Thái
    Molecular biology Robert F. Weaver University of Kansas – Lawrence 2th Edition.
    Giáo trình Công nghệ Sinh học phân tử - Nguyên lý và ứng dụng của ADN tái tổ hợp.NXB KHKT 2007.
    www.en.wikipedia.org
    www.google.com
    www.ncbi.nml.nih.gov
    And others websites and materials.
    Thanks you for your attention!
     
     
     
    Gửi ý kiến
    print